Part of Lesson Plan: Bioinformatics - Primer Design

Activity Overview / Details

Teacher should be familiar with searching on the internet and have general computer skills.  Students will be able to fill in gaps for the teacher - so don't be afraid to ask your students.

Teacher needs to familiarize self with National Center for Biotechnology Information (NCBI) and University of California Santa Cruz (UCSC) Genome Bioinformatics web pages. The NCBI website is http://www.ncbi.nlm.nih.gov/ and the UCSC Genome Bioinformatics wbsite is http://genome.ucsc.edu./.  I highly suggest doing one or two primer designs first from the student handout provided below so that demonstrating to the class goes smoothly.

If the teacher does not have computers in the classroom, reserve either the school's cart of laptops or time in the computer lab.  Try to obtain a ratio of two students per computer.

The following is the step by step guide (words only) for the example a teacher should use for the demonstration to the class:  (For a complete explanation (pictures included) look at the Bioinformatics Primer Design Handout.)

1.    Go to www.google.com.  Type in NCBI into the search engine.
2.    Click on “NCBI Homepage.”  NCBI stands for National Center for Biotechnology Information.  The address to go straight to NCBI is www.ncbi.nlm.nih.gov.  
3.    Click on the drop down box next to  “Search.”
4.    Choose the “Nucleotide” search.
5.    In the next blank drop down box (next to “for”) type in your locus accession.   This is the locus you signed up for in Table 1.
6.    Click the “GO” button.
7.    Click the blue number next to the title “CoreNucleotide Records.”
8.    Your specific locus for your disease should come up.  Click on the link to take you to that report.
9.    Make sure your information is from Homo sapiens (humans) by looking under “SOURCE.”  Fill this information into table 2.
10.     Check and record in table 2 how many bases are being referenced in your disease.
11.     Read through the information and discover exactly what disease the locus you are looking at deals with.  If you click on the numbers next to “PUBMED” a summary of that article will pop up and give you a lot of details.  Record the name of the disease in table 2.
12.    You want the sequence from the mRNA strand.  If you scroll down you will find “Origin.”  Highlight the entire mRNA sequence.  Copy the sequence using either your right click – Copy or EDIT – COPY.
13.    Do not include the poly-A tail at the end of the sequence.  Highlight everything except the multiple A’s at the end.  Only some of you will have this.
14.    Open a new window in your internet browser.  Do this by clicking on FILE – NEW – WINDOW.
15.     Go to http://genome.ucsc.edu.  You will use this site to determine what portions of your mRNA strand code for proteins (exons) and which portions do not code for proteins – or non-coding sections (introns).  It will also tell you exactly where in the human genome the locus can be found.
16.     Click on “BLAT.”
17.    In the white box under GENOME – HUMAN, use your right click to paste your mRNA sequence.
18.    Click “Submit.”
19.    Choose the query that is 100% under “IDENTITY” (or as close to 100% as possible).  To choose, click on “DETAILS.”
20.    Find your specific chromosome and locus location on top of the page.  Record this information in table 2.
21.    You need to also choose one exon from the entire gene to isolate and design primers for.  To choose an exon, click one of your “block1”, “block2”, “block 3”, etc.
22.    Those nucleotides (A, T, G, and C) that are blue are your exons – or portions of mRNA that code for proteins.  Those nucleotides that are black are introns – or non-coding segments.  Choose a “block” or exon that has enough blue nucleotides to isolate and minimally 100 black nucleotides before and after the blue segment.
23.    It is now time to design primers to cut out your exon.  You need to design both forward and reverse primers – a primer on the top of your exon and a primer on the bottom of your exon.  To be an ideal primer, it should:
a.    Be 20 base pairs (bp) long.
b.    Be 50% G and C for stability (meaning the other 50% is A and T).
c.    Be about 50 to150 bp away from the exon.
d.    End in G or C.  This is really hard to do, so don’t worry if you can’t get your primers to end in G or C.
e.    Do not choose a sequence that is complementary to itself and will fold into a hairpin.  For example ACACAC…GTGTGT will fold on itself because it is complement to itself.
24.     First we will work on the forward primer.  You want to find a series of 20 bases about 50-150 bp away from the start of the exon:
25.    After you have chosen 20 bases, make sure that there is a total of 10 G and C’s (or 50%).  If you met that requirement, you can try to find one that ends in a G or C to make sure it is the most stable primer you can design.  If you cannot find this combination, don’t worry.  It is more important to design a primer that is 50% G and C.  Remember to record your forward primer sequence in table 2.
26.     Next we will design the reverse primers.  Similarly to your forward primer, find a series of 20 bases about 50-150 bp away from the end of the exon.
27.    The reverse primer needs to be reverse compliment to the segment you chose.  For example, from the segment above “gc tgaattaacc ccctgaac” you need to first make the opposite DNA strand:
EXAMPLE: NM_000330 Retinoschisis
Set of 20 bases for reverse primer    gctgaattaaccccctgaac
Opposite DNA strand    cgacttaattgggggacttg 
28.    Now you must make the primer go in the reverse direction:
EXAMPLE: NM_000330 Retinoschisis
Opposite DNA strand    cgacttaattgggggacttg
Reverse Direction    caagtcccccaattaagtcg